Journal: Cell host & microbe
Article Title: Fungal trans-kingdom dynamics linked to responsiveness to fecal microbiota transplantation (FMT) therapy in ulcerative colitis
doi: 10.1016/j.chom.2020.03.006
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alkaline Phosphatase AffiniPure Goat Anti-Mouse IgG (H+L) Jackson Immuno Research Cat # 115-055-146 Bacterial and fungal Strains Candida albicans SC5314 ATCC MYA-2876 Biological samples Fecal samples from donor and UC FMT and placebo recipient Paramsothy et al., 2017 N/A Serum samples from UC FMT and placebo recipient Paramsothy et al., 2017 N/A Chemicals, Peptides, and Recombinant Proteins Fetal Bovine Serum Corning Cat# MT35016CV Lyticase from Arthrobacter luteus Sigma Cat# L2524 PNPP (p-nitrophenyl phosphate) Sigma Cat# 34045 Sabouraud dextrose broth VWR Cat# 89406-400 Critical Commercial Assays Quick-DNA Fungal/Bacterial Kit Zymo Research Cat# D6007 HighPrep™ PCR Clean-up System Magbiogenomics Cat# AC-60050 Kapa BiosystemsSupplier Diversity Partner HIFI HOTSTART READYMIX 500RXN Fisher Scientific Cat# KK2602 Nextera XT Index Kit v2 kit A Nextera XT Index Kit v2 Set B Illumina Cat# FC-131-200, FC-131-2002 QIAEX II Gel Extraction Kit Qiagen Cat# 20021 AccuPrime™ Taq DNA Polymerase, high fidelity Thermofisher Cat# 12346086 Oligonucleotides ITS1F: CTTGGTCATTTAGAGGAAGTAA, Li et al., 2018 N/A ITS2R: GCTGCGTTCTTCATCGATGC Li et al., 2018 NA Nextera Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific sequence] Illumina N/A Nextera Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[locus-specific sequence] Illumina NA Deposited Data 16S sequencing Paramsothy et al., 2017 European Nucleotide Archive, https://www.ebi.ac.uk/ena : PRJEB26472, PRJEB26474, PRJEB26473, PRJEB20349 and PRJEB26357 ITS Sequencing This paper NCBI BioProject repository, https://www.ncbi.nlm.nih.gov/bioproject/ : PRJNA590898 Software and Algorithms GraphPad Prim 8.3.0 (538) GraphPad Software N/A RStudio Desktop 1.2.1335 R Studio https://rstudio.com/ QIIME v1.6 QIIME www.qiime.org R version 3.5.0 (2018-04-23) R www.r-project.org Phyloseq v1.26.1 Phyloseq https://bioconductor.org/packages/release/bioc/html/phyloseq.html Vegan v2.5-5 Vegan https://cran.r-project.org/web/packages/vegan/ Estimation Stats DabestR v0.2.2 Ho et al, 2019 https://github.com/ACCLAB/dabestr Open in a separate window KEY RESOURCES TABLE
Techniques: Recombinant, Gel Extraction, Sequencing, Software
